Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250078

Morpholino Name: pcdh8.2 MO1
Synonyms: PAPC MO1, PAPC-MO, xpapc-Mo1
Target mRNA: pcdh8.2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTAGAAACAGTGTGGCAATGTGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' TTCACACTTGCACACTGTTTCTAGA 3' |||||| | |||||||||||||| 3' AAGTGTAACGGTGTGACAAAGATCC 5' 5' TTCACATTGCCACACTGTTTCTAGG 3' ||||||||||||||||||||||||| 3' AAGTGTAACGGTGTGACAAAGATCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:132078924..132078948 25/25 Antisense target pcdh8.2.L
chr7L:59864361..59864385 21/25 Antisense off-target LOC108696368 [provisional:draxin]
chr1L:95089908..95089932 22/25 unknown
tropicalis 10.0 Chr2:131713957..131713981 21/25 Antisense target pcdh8.2
Chr2:131713957..131713981 21/25 Antisense off-target Xetrov107017380m.g
Chr2:136116203..136116227 21/25 Sense off-target fkbp11
Chr4:85300395..85300419 21/25 unknown
Publications
First: Paraxial protocadherin coordinates cell polarity during convergent extension via Rho A and JNK., EMBO J 2004  
Most recent: Protocadherin PAPC is expressed in the CNC and can compensate for the loss of PCNS., Genesis 2014          
View All Papers