Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250079

Morpholino Name: pcdh8.2 MO2
Synonyms: MoPAPC 2, MoPAPC II, PAPC MO1, PAPC-MO, PAPC-MO2, papc II, papc2, xpapc MO2, xpapc-Mo2
Target mRNA: pcdh8.2

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGCCTAGAAAGAGTGCTGCTGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CACAGCAGCACTCTTTCTAGGCAAG 3' ||||||||||||||||||||||||| 3' GTGTCGTCGTGAGAAAGATCCGTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:114165403..114165427 25/25 Antisense target pcdh8.2.S
chr9_10S:49997116..49997140 21/25 Sense off-target LOC108702259 [provisional:lrp1b]
chr9_10L:109709218..109709242 21/25 unknown
tropicalis 10.0 Chr8:44629421..44629445 21/25 Antisense off-target LOC100492545
Chr1:73299311..73299335 21/25 unknown
Publications
First: Paraxial protocadherin coordinates cell polarity during convergent extension via Rho A and JNK., EMBO J 2004  
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
View All Papers