Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250081

Morpholino Name: pcdh8l MO1
Synonyms: PCNS M1, PCNS MO
Target mRNA: pcdh8l

Morpholino Type: uncategorized morpholino
Sequence: 5' GTGGTGTAGTTCTTAGAAGTAACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGTTACTTCTAAGAACTACACCAC 3' ||||||||||||||||||||||||| 3' TACAATGAAGATTCTTGATGTGGTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7S:25203588..25203612 25/25 Antisense target pcdh8l.S
chr1L:138584255..138584279 22/25 Sense off-target cdh24.L
chr1L:104531806..104531830 21/25 Sense off-target comp.L
chr8S:90969167..90969191 21/25 Sense off-target rprd2.S
Publications
First: PCNS: a novel protocadherin required for cranial neural crest migration and somite morphogenesis in Xenopus., Dev Biol 2006                
Most recent: Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a., Elife 2017                                                              
View All Papers