Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250112

Morpholino Name: pnhd MO3
Synonyms: 25H12.1moA
Target mRNA: pnhd

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTCATTCTGCCTGTTCATCACGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 23/25
genomic

MO
5' GCGTGATGAACAGGCAGAATGACAG 3' ||||||||||||||||||||||||| 3' CGCACTACTTGTCCGTCTTACTGTC 5' 5' GCGTGATGAACAGGCAGAATGACAG 3' ||||||||||||||||||||||||| 3' CGCACTACTTGTCCGTCTTACTGTC 5' 5' GTGTGATTAACAGGCAGAATGACAG 3' | ||||| ||||||||||||||||| 3' CGCACTACTTGTCCGTCTTACTGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:101959103..101959127 25/25 Antisense target pnhd.L
chr1S:89990787..89990811 23/25 Antisense target pnhd.S
chr8L:79007502..79007526 22/25 Antisense off-target six4.L
chr7L:119449337..119449361 21/25 Antisense off-target crocc.L
chr8L:85552341..85552365 21/25 unknown
tropicalis 10.0 Chr1:104459954..104459978 25/25 Antisense target pnhd
Chr1:104459954..104459978 25/25 Sense off-target LOC116412038
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers