Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250115

Morpholino Name: pou5f3.1 MO1
Synonyms: Oct91, XLPOU91, XLPOU91MO, XOct-91, oct91 MO1
Target mRNA: pou5f3.1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGTTGTGGGTAAAGGAAGGGTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25 25/25
genomic

MO
5' CTACCCTTCCTTTGCCCACCCCCCG 3' ||||||||||||| ||||| |||| 3' GATGGGAAGGAAATGGGTGTTGGGC 5' 5' CTACCCTTCCTTTACCCACAACCCA 3' |||||||||||||||||||||||| 3' GATGGGAAGGAAATGGGTGTTGGGC 5' 5' CTACCCTTCCTTTACCCACAACCCG 3' ||||||||||||||||||||||||| 3' GATGGGAAGGAAATGGGTGTTGGGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:27486455..27486479 25/25 Antisense target pou5f3.1.S
chr8L:2150661..2150685 24/25 Antisense target pou5f3.1.L
chr6S:29752639..29752663 21/25 Sense off-target ahr.S
chr6S:8433945..8433969 21/25 Sense off-target rheb.S
Scaffold100:32282..32306 21/25 unknown
tropicalis 10.0 Chr8:3301443..3301467 22/25 Antisense target pou5f3.1
Chr1:182210674..182210698 21/25 Sense off-target fam151b
Chr5:75104066..75104090 21/25 Antisense off-target nt5dc1
Chr5:75104066..75104090 21/25 Sense off-target col10a1
Chr9:25570332..25570356 21/25 Sense off-target aimp2
Chr10:2272713..2272737 21/25 unknown
Publications
First: Xenopus laevis POU91 protein, an Oct3/4 homologue, regulates competence transitions from mesoderm to neural cell fates., EMBO J 2006  
Most recent: Interaction of Sox1, Sox2, Sox3 and Oct4 during primary neurogenesis., Dev Biol 2011          
View All Papers