Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250152

Morpholino Name: prickle1 MO1
Synonyms: Pk1, XpkU MO, xPrickle1 MO
Target mRNA: prickle1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCTGATCCATTTCCAAAGGCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 22/25 25/25
genomic

MO
5' CATGCCTTTGGAAATGGATCAGAAA 3' |||||||||||||||||||||||| 3' GTACGGAAACCTTTACCTAGTCTTC 5' 5' CATGTCGTTGGAAATGGATCAGAAA 3' |||| | ||||||||||||||||| 3' GTACGGAAACCTTTACCTAGTCTTC 5' 5' CATGCCTTTGGAAATGGATCAGAAG 3' ||||||||||||||||||||||||| 3' GTACGGAAACCTTTACCTAGTCTTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:82061559..82061583 25/25 Antisense target prickle1.S
chr3L:56105040..56105064 22/25 Antisense target prickle1.L
chr4L:31083646..31083670 21/25 Antisense off-target nutf2.L
chr2L:84990741..84990765 21/25 unknown
chr4L:5527452..5527476 21/25 unknown
chr4S:23414353..23414377 21/25 unknown
tropicalis 10.0 Chr3:64769790..64769814 24/25 Antisense target prickle1
Chr6:54918003..54918027 22/25 Sense off-target lars2
Chr4:41272503..41272527 21/25 Antisense off-target nutf2
Chr4:61959925..61959949 21/25 unknown
Publications
First: The prickle-related gene in vertebrates is essential for gastrulation cell movements., Curr Biol 2003          
Most recent: PAPC mediates self/non-self-distinction during Snail1-dependent tissue separation., J Cell Biol 2015                      
View All Papers