Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250181

Morpholino Name: pzp MO1
Synonyms: Endodermin
Target mRNA: pzp

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGGGTAAGAGCGCAGCTCCACATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:5560817..5560841 23/25 Antisense off-target LOC108696033
Chr7L:5595054..5595078 23/25 Antisense off-target LOC108696033
Chr7S:3823823..3823847 21/25 Antisense off-target a2m.S
tropicalis 10.0 Chr7:7963822..7963846 25/25 Antisense off-target a2m
Chr7:8036190..8036214 25/25 Antisense off-target LOC100489060
Chr3:125226042..125226066 22/25 Sense off-target lman2l
Publications
First: Microarray-based identification of VegT targets in Xenopus., Mech Dev 2005                                            
Most recent:
View All Papers