Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250199

Morpholino Name: rara MO5
Synonyms: Rara.S MO, Raralpha2.1, rar alpha.S MO
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGAAATCCAAACTGACCATAGAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACTCTATGGTCAGTTTGGATTTCAG 3' ||||||||||||||||||||||||| 3' TGAGATACCAGTCAAACCTAAAGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:1464438..1464462 25/25 Antisense target rara.S
Chr3L:154729737..154729761 21/25 Antisense off-target LOC108710424
Chr3L:154955013..154955037 21/25 Antisense off-target LOC108710437
Chr3L:155042129..155042153 21/25 Antisense off-target LOC108710444
Chr3L:154620009..154620033 21/25 unknown
Chr5S:25760236..25760260 21/25 unknown
Chr5S:59932082..59932106 21/25 unknown
tropicalis 10.0 Chr3:146150203..146150227 21/25 Antisense off-target LOC100496182
Chr7:106714137..106714161 21/25 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent: RARγ is required for mesodermal gene expression prior to gastrulation in Xenopus., Development 2018                            
View All Papers