Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250201

Morpholino Name: rarg MO1
Synonyms: Rar gamma 1.L/S , Rargamma1
Target mRNA: rarg

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGTTTGCCATTGCCTTGTTCTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 24/24
genomic

MO
5' GAGAACAAGACAATGGCAAACAGC 3' |||||||| |||||||||||||| 3' ATCTTGTTCCGTTACCGTTTGTCG 5' 5' TAGAACAAGGCAATGGCAAACAGC 3' |||||||||||||||||||||||| 3' ATCTTGTTCCGTTACCGTTTGTCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:138904670..138904693 24/24 Antisense target rarg.S
Chr2L:155408302..155408325 23/24 Antisense off-target LOC108708649
Chr1S:167432829..167432852 21/24 Sense off-target mef2c.S
Chr2L:182397480..182397503 20/24 Sense off-target LOC121399681
Chr3L:29537357..29537380 21/24 unknown
Chr3L:29542339..29542362 21/24 unknown
Chr5S:90111824..90111847 21/24 unknown
Chr6S:34091449..34091472 21/24 unknown
Chr1S:167176414..167176437 20/24 unknown
Chr2S:25689322..25689345 20/24 unknown
Chr4L:86108893..86108916 20/24 unknown
Chr5L:21062514..21062537 20/24 unknown
Chr9_10L:77464850..77464873 20/24 unknown
tropicalis 10.0 Chr2:147287088..147287111 22/24 Antisense target rarg
Chr6:62975732..62975755 21/24 Sense off-target pou6f2
Chr2:176095761..176095784 20/24 Sense off-target LOC100486100
Chr1:130184287..130184310 20/24 unknown
Publications
First: ERF and ETV3L are retinoic acid-inducible repressors required for primary neurogenesis., Development 2013                                                                
Most recent: RARγ is required for mesodermal gene expression prior to gastrulation in Xenopus., Development 2018                            
View All Papers