Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250222

Morpholino Name: rbpj MO5
Synonyms: XSu(H)2, alpha-SAUG, alpha-SAUG2
Target mRNA: rbpj

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCTCTCCCCAAACTTCATTCCGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:116439141..116439165 22/25 Sense off-target LOC108701962 [provisional:gm4070]
chr9_10L:51031787..51031811 22/25 Sense off-target zranb3.L
chr4L:126310227..126310251 21/25 Sense off-target tmcc1.L
chr4L:133457346..133457370 21/25 Sense off-target LOC108714690 [provisional:nuak1]
chr8S:12812937..12812961 21/25 Sense off-target tmx1.S
chr9_10S:93119600..93119624 21/25 Antisense off-target ntn3.S
chr7S:46264971..46264995 23/25 unknown
chr1L:6897554..6897578 22/25 unknown
chr1L:89982240..89982264 22/25 unknown
chr2L:74551296..74551320 22/25 unknown
chr3S:23458806..23458830 22/25 unknown
chr4S:36441058..36441082 22/25 unknown
chr5L:57789460..57789484 22/25 unknown
chr6L:2580276..2580300 22/25 unknown
chr9_10L:6610040..6610064 21/25 unknown
tropicalis 10.0 Chr9:84543008..84543032 21/25 Sense off-target tmem163
Publications
First: EDEN-BP-dependent post-transcriptional regulation of gene expression in Xenopus somitic segmentation., Development 2004                    
Most recent: A strategy to analyze the phenotypic consequences of inhibiting the association of an RNA-binding protein with a specific RNA., RNA 2010  
View All Papers