Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250229

Morpholino Name: reep4 MO1
Synonyms: reep4 MO3
Target mRNA: reep4

Morpholino Type: uncategorized morpholino
Sequence: 5' ACGGGAGATGATCCAAGACACCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GATGGTGTCCTGGATCATCTCCCGG 3' ||||||||| |||||||||||||| 3' CTACCACAGAACCTAGTAGAGGGCA 5' 5' GATGGTGTCTTGGATCATCTCCCGT 3' ||||||||||||||||||||||||| 3' CTACCACAGAACCTAGTAGAGGGCA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:23002875..23002899 25/25 Antisense target reep4.S
chr3L:122409494..122409518 23/25 Antisense target reep4.L
chr3L:40975989..40976013 22/25 Antisense off-target reep2.L
chr3S:97102097..97102121 22/25 Antisense off-target reep2.S
Publications
First: Loss of REEP4 causes paralysis of the Xenopus embryo., Int J Dev Biol 2009            
Most recent:
View All Papers