Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250230

Morpholino Name: reep4 MO2
Synonyms: TEgg068f10, Xtnovel51
Target mRNA: reep4

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAGAGATGATCCAGGATACCATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25
genomic

MO
5' GAATGGTATCCTGGATCATCTCTCG 3' ||||||||||||||||||||||||| 3' CTTACCATAGGACCTAGTAGAGAGC 5' 5' GGATGGTGTCCTGGATCATCTCCCG 3' | ||||| |||||||||||||| || 3' CTTACCATAGGACCTAGTAGAGAGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:122409495..122409519 22/25 Antisense target reep4.L
chr3L:40975988..40976012 21/25 Antisense off-target reep2.L
chr3S:97102098..97102122 21/25 Antisense off-target reep2.S
chr6S:93289308..93289332 21/25 Sense off-target sdcbp.S
tropicalis 10.0 Chr3:129585451..129585475 25/25 Antisense target reep4
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Loss of REEP4 causes paralysis of the Xenopus embryo., Int J Dev Biol 2009            
View All Papers