Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250231

Morpholino Name: reep4 MO3
Synonyms: TEgg068f10, Xtnovel51.2, reep4 MO1
Target mRNA: reep4

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTCACTGACACTGTCTCCCTCACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGTGAGGGAGACAGTGTCAGTGAGG 3' ||||||||||||||||||||||||| 3' ACACTCCCTCTGTCACAGTCACTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:28998949..28998973 22/25 Antisense off-target atp1a1.S
chr5L:159109393..159109417 22/25 Antisense off-target gpn1.L
chr6L:85094976..85095000 22/25 Antisense off-target exoc2.L
Scaffold54:517486..517510 21/25 Sense off-target LOC108704854
chr8S:97550365..97550389 21/25 Antisense off-target smad4.2.S
chr9_10S:379808..379832 21/25 Sense off-target stat5b.S
chr6L:85962902..85962926 21/25 unknown
chr8S:97550279..97550303 21/25 unknown
chr8S:97550307..97550331 21/25 unknown
tropicalis 10.0 Chr3:129585478..129585502 25/25 Antisense target reep4
Chr8:121366661..121366685 21/25 Antisense off-target LOC100485074
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent: Loss of REEP4 causes paralysis of the Xenopus embryo., Int J Dev Biol 2009            
View All Papers