Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250234

Morpholino Name: rfx2 MO1
Synonyms: Rfx2, Rfx2 MO
Target mRNA: rfx2

Morpholino Type: uncategorized morpholino
Sequence: 5' AATTCTGCATACTGGTTTCTCCGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 21/25
genomic

MO
5' TGCACAGAAACCAGTATGCAGAATT 3' | |||||||||||||||||||| 3' CTGCCTCTTTGGTCATACGTCTTAA 5' 5' TTCACAGAAACCAGTATGCAGAATT 3' | |||||||||||||||||||| 3' CTGCCTCTTTGGTCATACGTCTTAA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:98978457..98978481 21/25 Antisense target rfx2.L
chr1S:87327999..87328023 21/25 Antisense target rfx2.S
Scaffold22:3851316..3851340 21/25 Antisense off-target Xelaev18001547m
Scaffold22:3851316..3851340 21/25 Antisense off-target LOC108703891
tropicalis 10.0 Chr3:130119587..130119611 21/25 Sense off-target rhobtb2
Chr3:68596958..68596982 21/25 Sense off-target cttnbp2
Chr5:58384517..58384541 21/25 Sense off-target slc35d3
Publications
First: RFX2 is broadly required for ciliogenesis during vertebrate development., Dev Biol 2012                                                            
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers