Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250246

Morpholino Name: ripk4 MO1
Synonyms: Ripk4-MO1
Target mRNA: ripk4

Morpholino Type: uncategorized morpholino
Sequence: 5' GGACGCGCCCTCCTTATCCACCATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TATGGTGGATAAGGAGGGCGCGTCC 3' ||||||||||||||||||||||||| 3' ATACCACCTATTCCTCCCGCGCAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:9359639..9359663 25/25 Antisense target ripk4.L
Chr2S:23154583..23154607 25/25 Antisense off-target LOC108709253
Publications
First: Phosphorylation of Dishevelled by protein kinase RIPK4 regulates Wnt signaling., Science 2013  
Most recent:
View All Papers