Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250248

Morpholino Name: ripply2.1 MO1
Synonyms: ledgerline MO
Target mRNA: ripply2.1

Morpholino Type: uncategorized morpholino
Sequence: 5' AACTCCGCTGTTGATTCGGCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ATGGAGCCGAATCAACAGCGGAGTT 3' ||||||||||||||||||||||||| 3' TACCTCGGCTTAGTTGTCGCCTCAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5S:70438036..70438060 25/25 Antisense target ripply2.1.S
Publications
First: Ledgerline, a novel Xenopus laevis gene, regulates differentiation of presomitic mesoderm during somitogenesis., Zoolog Sci 2006    
Most recent: The Xenopus Bowline/Ripply family proteins negatively regulate the transcriptional activity of T-box transcription factors., Int J Dev Biol 2009                      
View All Papers