Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250251

Morpholino Name: rnd1 MO1
Synonyms: Rnd1, Rnd1 MO, Rnd1-MO
Target mRNA: rnd1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGGTTCCTTCGTTCCTTCATGGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 22/25
genomic

MO
5' CACCATGAAGGAGAGAAGGAACCCA 3' |||||||||||| ||||||||||| 3' GTGGTACTTCCTTGCTTCCTTGGGT 5' 5' CACCATGAAGGAACGAAGGAACCCA 3' ||||||||||||||||||||||||| 3' GTGGTACTTCCTTGCTTCCTTGGGT 5' 5' CACCATGAAGGAAAGGAGGAGCCCA 3' ||||||||||||| | |||| |||| 3' GTGGTACTTCCTTGCTTCCTTGGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:136704653..136704677 25/25 Antisense target rnd1.L
chr2S:118538332..118538356 22/25 Antisense target rnd1.S
chr2S:70786473..70786497 21/25 Sense off-target tmem39b.S
tropicalis 10.0 Chr2:136036539..136036563 23/25 Antisense target rnd1
Publications
First: TGF-beta signaling-mediated morphogenesis: modulation of cell adhesion via cadherin endocytosis., Genes Dev 2007                    
Most recent: A protocadherin-cadherin-FLRT3 complex controls cell adhesion and morphogenesis., PLoS One 2009                      
View All Papers