Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250252

Morpholino Name: rnd3 MO1
Synonyms: Rnd3-MO
Target mRNA: rnd3

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGACTCGTTCTTCTTTCCTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGAAGGAAAGAAGAACGAGTCAGA 3' ||||||||||||||||||||||||| 3' TACTTCCTTTCTTCTTGCTCAGTCT 5' 5' ATGAAGGAAAGAAGAACGAGTCAGA 3' ||||||||||||||||||||||||| 3' TACTTCCTTTCTTCTTGCTCAGTCT 5' 5' ATGAAGGAAAGAAGAACGAGTCAGA 3' ||||||||||||||||||||||||| 3' TACTTCCTTTCTTCTTGCTCAGTCT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:57647809..57647833 25/25 Antisense target rnd3.L
chr9_10S:52846068..52846092 25/25 Antisense target rnd3.S
tropicalis 10.0 Chr9:76555437..76555461 25/25 Antisense target rnd3
Chr2:109324262..109324286 21/25 Sense off-target lims1
Chr2:149078633..149078657 21/25 Sense off-target LOC100492173
Publications
First: Xenopus Rnd1 and Rnd3 GTP-binding proteins are expressed under the control of segmentation clock and required for somite formation., Dev Dyn 2009              
Most recent:
View All Papers