Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250300

Morpholino Name: shh MO1
Synonyms: Shh ATG MO
Target mRNA: shh

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTCGTCCGAGCGAAGCCAATTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' GTAATTGGCTTCGCTCGGACGAGAT 3' ||||||||||||||||||||||||| 3' CATTAACCGAAGCGAGCCTGCTCTA 5' 5' GTAATTGGCTTCGCTCGGACGAGAT 3' ||||||||||||||||||||||||| 3' CATTAACCGAAGCGAGCCTGCTCTA 5' 5' GTCATTGGCTTCGCTCGGACGAGAT 3' || |||||||||||||||||||||| 3' CATTAACCGAAGCGAGCCTGCTCTA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:13113307..13113331 25/25 Antisense target shh.L
chr6S:10782053..10782077 24/25 Antisense target shh.S
tropicalis 10.0 Chr6:17023030..17023054 25/25 Antisense target shh
Chr8:91390976..91391000 21/25 unknown
Publications
First: A revised model of Xenopus dorsal midline development: differential and separable requirements for Notch and Shh signaling., Dev Biol 2011                                
Most recent:
View All Papers