Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250307

Morpholino Name: shroom3 MO1
Synonyms: shroom3 MO
Target mRNA: shroom3

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCATACATACCCTCTCATCAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/23 21/23
genomic

MO
5' CCTGATGAGAGGGTATGTATGCA 3' ||||||||||||||||||||||| 3' GGACTACTCTCCCATACATACGT 5' 5' GCTGAAGAGAGGGTATGTATGCA 3' |||| ||||||||||||||||| 3' GGACTACTCTCCCATACATACGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:76357600..76357622 21/23 Antisense target shroom3.L
Scaffold195:500..522 20/23 Antisense off-target LOC108705595 [provisional:shroom3]
chr6L:13727584..13727606 19/23 Antisense off-target ube3c.L
Scaffold50:696564..696586 19/23 Antisense off-target LOC108704800 [provisional:itih6]
chr2S:11579563..11579585 19/23 unknown
chr4S:92997327..92997349 19/23 unknown
chr5L:69715029..69715051 19/23 unknown
tropicalis 10.0 Chr1:88099951..88099973 23/23 Antisense target shroom3
Publications
First: Shroom induces apical constriction and is required for hingepoint formation during neural tube closure., Curr Biol 2003                            
Most recent: Mechanical roles of apical constriction, cell elongation, and cell migration during neural tube formation in Xenopus., Biomech Model Mechanobiol 2016                
View All Papers