Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250308

Morpholino Name: sia1 MO1
Synonyms: Sia-MO, Siamois, Sia MO, Siamois-MO
Target mRNA: sia1

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCAGCCTCATAGGTCATGTCTGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GACAGACATGACCTGTGAGGCTGAA 3' |||||||||||||| |||||||||| 3' CTGTCTGTACTGGATACTCCGACTT 5' 5' GACAGACATGACCTATGAGGCTGAA 3' ||||||||||||||||||||||||| 3' CTGTCTGTACTGGATACTCCGACTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:136221761..136221785 25/25 Antisense target sia1.L
Scaffold20:4041730..4041754 22/25 Antisense off-target LOC108703460
chr9_10S:18571792..18571816 22/25 Sense off-target XB5729910.S
tropicalis 10.0 Chr3:144294204..144294228 24/25 Antisense target sia1
Publications
First: Expression of Siamois and Twin in the blastula Chordin/Noggin signaling center is required for brain formation in Xenopus laevis embryos., Mech Dev 2008                
Most recent: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
View All Papers