Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250309

Morpholino Name: sia1 MO2
Synonyms: Sia MO
Target mRNA: sia1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCCATTTCAGCCTCATAGGTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 22/25
genomic

MO
5' ATGACCTGTGAGGCTGAAATGGAGC 3' ||||||| ||||||||||||||||| 3' TACTGGATACTCCGACTTTACCTCG 5' 5' ATGACCTATGAGGCTGAAATGGAGC 3' ||||||||||||||||||||||||| 3' TACTGGATACTCCGACTTTACCTCG 5' 5' ATGACTTGTGAGGCTGAAACGGAGC 3' ||||| | ||||||||||| ||||| 3' TACTGGATACTCCGACTTTACCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:136221768..136221792 25/25 Antisense target sia1.L
Scaffold20:4038697..4038721 22/25 Antisense target sia1.S
chr1L:168098772..168098796 21/25 unknown
tropicalis 10.0 Chr3:144294211..144294235 24/25 Antisense target sia1
Publications
First: Siamois and Twin are redundant and essential in formation of the Spemann organizer., Dev Biol 2011                      
Most recent: Early neural ectodermal genes are activated by Siamois and Twin during blastula stages., Genesis 2015            
View All Papers