Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250347

Morpholino Name: smoc1 MO1
Synonyms: XSMOC-1 MO, xsmoc-1 MO1
Target mRNA: smoc1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCATGTTGCCTCTTCTTATACAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' CCTGTGTAAGAAGAGGCAACATGAT 3' ||||| |||||||||||||||||| 3' GGACATATTCTTCTCCGTTGTACTG 5' 5' CCTGTATAAGAAGAGGCAACATGAC 3' ||||||||||||||||||||||||| 3' GGACATATTCTTCTCCGTTGTACTG 5' 5' CCTGTATAAGAAGAGGCAACATGAC 3' ||||||||||||||||||||||||| 3' GGACATATTCTTCTCCGTTGTACTG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:84968160..84968184 25/25 Antisense target smoc1.L
chr8S:3854081..3854105 25/25 Antisense target smoc1.S
chr8L:84968160..84968184 25/25 Antisense off-target fntb.L
chr3S:86215138..86215162 23/25 unknown
Scaffold55:875912..875936 21/25 unknown
tropicalis 10.0 Chr8:107639590..107639614 23/25 Antisense target smoc1
Chr1:111286599..111286623 21/25 unknown
Chr5:138650515..138650539 21/25 unknown
Publications
First: Xenopus SMOC-1 Inhibits bone morphogenetic protein signaling downstream of receptor binding and is essential for postgastrulation development in Xenopus., J Biol Chem 2009                      
Most recent:
View All Papers