Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250348

Morpholino Name: smoc1 MO2
Synonyms: XSMOC-1 MO2, xsmoc-2 MO2
Target mRNA: smoc1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAATCAGGCGTGAGACTTGTATGAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTCATACAAGTCTCACGCCTGATTG 3' ||||||||||||||||||||||||| 3' AAGTATGTTCAGAGTGCGGACTAAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8L:84968203..84968227 25/25 Antisense target smoc1.L
chr8L:84968203..84968227 25/25 Antisense off-target fntb.L
Scaffold13551:7..31 22/25 unknown
Publications
First: Xenopus SMOC-1 Inhibits bone morphogenetic protein signaling downstream of receptor binding and is essential for postgastrulation development in Xenopus., J Biol Chem 2009                      
Most recent:
View All Papers