Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250378

Morpholino Name: sox3 MO1
Synonyms: 30F5.2moA
Target mRNA: sox3

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCTGTGTCCAACATGCTATACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genomic

MO
5' ATGTATAGCATGTTGGACACAGACC 3' ||||||||||||||||||||||||| 3' TACATATCGTACAACCTGTGTCTGG 5' 5' ATGTATAGCATGTTGGACACAGACA 3' |||||||||||||||||||||||| 3' TACATATCGTACAACCTGTGTCTGG 5' 5' ATGTATAGCATGTTGGACACCGACA 3' |||||||||||||||||||| ||| 3' TACATATCGTACAACCTGTGTCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:33820528..33820552 24/25 Antisense target sox3.L
chr8S:61007073..61007097 23/25 Antisense target sox3.S
chr2L:180231054..180231078 22/25 Sense off-target tsku.L
tropicalis 10.0 Chr8:55347976..55348000 25/25 Antisense target sox3
Chr4:32818025..32818049 21/25 Antisense off-target atg2a
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers