Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250382

Morpholino Name: sox5 MO1
Synonyms: xSox5 MO
Target mRNA: sox5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CTCGGGCTCAGTGAGCATTTCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/23 23/23
genomic

MO
5' CAGAAATGCTCAGTGAGCCCGAG 3' |||||||||||| |||||||||| 3' GTCTTTACGAGTGACTCGGGCTC 5' 5' CAGAAATGCTCACTGAGCCCGAG 3' ||||||||||||||||||||||| 3' GTCTTTACGAGTGACTCGGGCTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3S:917741..917763 23/23 Antisense target sox5.S
chr3L:1295978..1296000 22/23 Antisense target sox5.L
chr9_10S:102149896..102149918 19/23 Antisense off-target srrm2.S
chr2S:18298777..18298799 19/23 unknown
tropicalis 10.0 Chr4:6487846..6487868 20/23 unknown
Publications
First: The protein kinase MLTK regulates chondrogenesis by inducing the transcription factor Sox6., Development 2012                          
Most recent:
View All Papers