Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250383

Morpholino Name: sox6 MO1
Synonyms: xSox6 MO
Target mRNA: sox6

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGGCTTGCTTGGAAGACATCCTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' GAAGGATGTCTTCCAAGCAAGCCGC 3' |||||||||||||||||||||||| 3' ATTCCTACAGAAGGTTCGTTCGGCG 5' 5' GAAGGATGTCTTCCAAGCAAGCCGC 3' |||||||||||||||||||||||| 3' ATTCCTACAGAAGGTTCGTTCGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4S:21943219..21943243 24/25 Antisense target sox6.S
chr4L:1355450..1355474 24/25 Antisense off-target LOC108713441
chr4S:21943219..21943243 24/25 Antisense off-target LOC108715311
tropicalis 10.0 Chr4:2720776..2720800 24/25 Antisense target sox6
Publications
First: The protein kinase MLTK regulates chondrogenesis by inducing the transcription factor Sox6., Development 2012                          
Most recent:
View All Papers