Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250403

Morpholino Name: spry1 MO2
Synonyms: XSpry1-MO
Target mRNA: spry1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCCATGTTGACTTTGTAGCTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGAGCTACAAAGTCAACATGGCA 3' ||||||||||||||||||||||||| 3' TACCTCGATGTTTCAGTTGTACCGT 5' 5' ATGGAGCTACAAAGTCAACATGGCA 3' ||||||||||||||||||||||||| 3' TACCTCGATGTTTCAGTTGTACCGT 5' 5' ATGGAGCTACAAAGTCAACATGGCA 3' ||||||||||||||||||||||||| 3' TACCTCGATGTTTCAGTTGTACCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:58820374..58820398 25/25 Antisense target spry1.L
chr1S:54035826..54035850 25/25 Antisense target spry1.S
chr4S:86565607..86565631 21/25 Sense off-target csdc2.S
chr5L:50802019..50802043 21/25 unknown
chr9_10S:48892496..48892520 21/25 unknown
tropicalis 10.0 Chr1:65663786..65663810 25/25 Antisense target spry1
Publications
First: Regulation of ERK activity duration by Sprouty contributes to dorsoventral patterning., Nat Cell Biol 2009  
Most recent:
View All Papers