Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250408

Morpholino Name: srf MO1
Synonyms: XSRF MO1
Target mRNA: srf

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGTTACTGGGCAGCATCCCTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 24/24
genomic

MO
5' CAAGGGATGCTGCCCAGTAACCAG 3' |||||||||||||||||||||||| 3' GTTCCCTACGACGGGTCATTGGTC 5' 5' CAAGGGATGCTGCCCAGTAACCAG 3' |||||||||||||||||||||||| 3' GTTCCCTACGACGGGTCATTGGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:24674921..24674944 24/24 Antisense target srf.L
Chr5S:6732251..6732274 24/24 Antisense target srf.S
Chr4L:12314759..12314782 20/24 Antisense off-target LOC108713799
Chr4S:58112786..58112809 20/24 Antisense off-target ddah1.S
Chr2S:107528290..107528313 21/24 unknown
Chr2S:97929399..97929422 21/24 unknown
tropicalis 10.0 Chr4:23403568..23403591 20/24 Antisense off-target dagla
Chr7:129960969..129960992 21/24 unknown
Chr4:23480950..23480973 20/24 unknown
Chr4:23605888..23605911 20/24 unknown
Chr4:23554026..23554049 20/24 unknown
Publications
First: Negative regulation of Activin/Nodal signaling by SRF during Xenopus gastrulation., Development 2007                
Most recent:
View All Papers