Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250436

Morpholino Name: suz12 MO1
Synonyms: Suz12 MO, Suz12MO
Target mRNA: suz12

Morpholino Type: uncategorized morpholino
Sequence: 5' CCATGCGGGATACTACGAGTGATAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' TTATCGCTTGTAGTATCCCGCATGG 3' ||||| || |||||||||||||||| 3' AATAGTGAGCATCATAGGGCGTACC 5' 5' TTATCACTCGTAGTATCCCGCATGG 3' ||||||||||||||||||||||||| 3' AATAGTGAGCATCATAGGGCGTACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:40382723..40382747 25/25 Antisense target suz12.S
chr9_10L:44360337..44360361 23/25 Antisense target suz12.L
tropicalis 10.0 Chr4:16029330..16029354 21/25 Antisense off-target fnbp4
Publications
First: Jarid2/Jumonji coordinates control of PRC2 enzymatic activity and target gene occupancy in pluripotent cells., Cell 2009  
Most recent: Geminin cooperates with Polycomb to restrain multi-lineage commitment in the early embryo., Development 2011                      
View All Papers