Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250441

Morpholino Name: tbxt.2 MO1
Synonyms: xbra
Target mRNA: tbxt.2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATAGTATTGATGATGTCTCCTCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CAGAGGAGACATCATCAATACTATG 3' ||||||||||||||||||||||||| 3' GTCTCCTCTGTAGTAGTTATGATAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:56140344..56140368 25/25 Antisense target tbxt.2.L
chr3S:64404277..64404301 22/25 Sense off-target LOC108713037 [provisional:plxna4]
tropicalis 10.0 Chr6:95322767..95322791 22/25 unknown
Publications
First: Neurotrophin receptor homolog (NRH1) proteins regulate mesoderm formation and apoptosis during early Xenopus development., Dev Biol 2006                    
Most recent:
View All Papers