Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250458

Morpholino Name: tbx6 MO2
Synonyms: Tbx6 ATG
Target mRNA: tbx6

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTCAGAGTGGTACATGGCTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:42066472..42066494 20/23 Sense off-target LOC108713501 [provisional:htr3a]
chr4L:42100521..42100543 20/23 Sense off-target LOC108713502 [provisional:htr3a]
chr4L:42151037..42151059 20/23 Sense off-target htr3a.L
chr4S:32333205..32333227 20/23 Sense off-target LOC108714962 [provisional:htr3a]
chr4S:32369185..32369207 20/23 Sense off-target LOC108714963 [provisional:htr3a]
chr2S:102688687..102688709 19/23 Antisense off-target gpr183.S
chr4S:58817308..58817330 19/23 Sense off-target dnajc6.S
Scaffold18304:529..551 23/23 unknown
Scaffold23474:504..526 23/23 unknown
tropicalis 10.0 Chr4:52323318..52323340 21/23 Sense off-target LOC100494266
Chr3:8614709..8614731 19/23 Sense off-target mical3
Publications
First: A divergent Tbx6-related gene and Tbx6 are both required for neural crest and intermediate mesoderm development in Xenopus., Dev Biol 2010                  
Most recent:
View All Papers