Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250460

Morpholino Name: tbx6 MO4
Synonyms: Tbx6 splicing morpholino (T6sp1)
Target mRNA: tbx6

Morpholino Type: uncategorized morpholino
Sequence: 5' CACCTGATCGTCTCACCTGCCAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold83030:130..154 25/25 unknown
Publications
First: A divergent Tbx6-related gene and Tbx6 are both required for neural crest and intermediate mesoderm development in Xenopus., Dev Biol 2010                  
Most recent:
View All Papers