Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250463

Morpholino Name: tbx6r MO3
Synonyms:
Target mRNA: tbx6r

Morpholino Type: uncategorized morpholino
Sequence: 5' GTGAACATGCCCACCCATCTCTCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:143255138..143255162 21/25 Antisense off-target LOC108709988 [provisional:gucy1a2]
chr7L:117719345..117719369 21/25 Antisense off-target LOC108696824 [provisional:iglon5]
Scaffold35:771948..771972 21/25 unknown
tropicalis 10.0 Chr5:37780065..37780089 21/25 unknown
Publications
First: A divergent Tbx6-related gene and Tbx6 are both required for neural crest and intermediate mesoderm development in Xenopus., Dev Biol 2010                  
Most recent:
View All Papers