Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250464

Morpholino Name: tbx6r MO4
Synonyms: Tbx6r
Target mRNA: tbx6r

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCAGGCAATTGGCACCTACCTGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:78880871..78880895 21/25 unknown
tropicalis 10.0 Chr9:2411316..2411340 24/25 Antisense off-target LOC101732669
Chr7:14464347..14464371 21/25 Antisense off-target pcdh15
Publications
First: A divergent Tbx6-related gene and Tbx6 are both required for neural crest and intermediate mesoderm development in Xenopus., Dev Biol 2010                  
Most recent:
View All Papers