Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250487

Morpholino Name: tes MO2
Synonyms:
Target mRNA: tes

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTACGCGTTCTTCTGCTTCTTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:78010935..78010958 20/24 Antisense off-target LOC108701442 [provisional:plcl1]
chr4S:6870057..6870080 20/24 unknown
tropicalis 10.0 Chr2:59003618..59003641 21/24 Sense off-target shroom2
Chr2:2089991..2090014 20/24 Antisense off-target hao2
Chr2:2089991..2090014 20/24 Sense off-target wars2
Chr7:130593401..130593424 21/24 unknown
Chr2:44024979..44025002 20/24 unknown
Chr7:130591380..130591403 20/24 unknown
Chr7:130591536..130591559 20/24 unknown
Chr7:130592211..130592234 20/24 unknown
Chr7:130592334..130592357 20/24 unknown
Chr7:130592690..130592713 20/24 unknown
Chr7:130592750..130592773 20/24 unknown
Chr7:130592855..130592878 20/24 unknown
Chr7:130592939..130592962 20/24 unknown
Chr7:130593023..130593046 20/24 unknown
Chr7:130593212..130593235 20/24 unknown
Chr7:130593248..130593271 20/24 unknown
Chr7:130593272..130593295 20/24 unknown
Chr7:130593461..130593484 20/24 unknown
Chr7:130593650..130593673 20/24 unknown
Chr7:130593767..130593790 20/24 unknown
Chr7:130591707..130591730 20/24 unknown
Chr7:130591791..130591814 20/24 unknown
Chr7:130592067..130592090 20/24 unknown
Publications
First: Tes regulates neural crest migration and axial elongation in Xenopus., Dev Biol 2006                            
Most recent:
View All Papers