Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250495

Morpholino Name: tgfbi MO1
Synonyms: Xtgfbi MO1
Target mRNA: tgfbi

Morpholino Type: uncategorized morpholino
Sequence: 5' GAAACTGAAAAACACCAGTGAATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GAATTCGTTGGTGTTTTTCAGTTTT 3' |||||| |||||||||||||||| 3' CTTAAGTGACCACAAAAAGTCAAAG 5' 5' GAATTCACTGGTGTTTTTCAGTTTC 3' ||||||||||||||||||||||||| 3' CTTAAGTGACCACAAAAAGTCAAAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 7.1 Scaffold18892:9226164..9226188 25/25 Antisense target tgfbi.L
Scaffold48253:5048630..5048654 24/25 Antisense off-target Xelaev16057598m
Scaffold15215:129265..129289 22/25 Sense off-target Xelaev16015169m
Scaffold294828:473153..473177 22/25 Antisense off-target epha4.L
Scaffold13265:3233932..3233956 21/25 Antisense off-target Xelaev16009342m
Scaffold236382:3339122..3339146 21/25 Antisense off-target Xelaev16031450m
Scaffold29017:573247..573271 21/25 Sense off-target gnaq.L
tropicalis 7.1 scaffold_3:68126617..68126641 22/25 Antisense target tgfbi
scaffold_5:13072908..13072932 22/25 Antisense off-target usp13
Publications
First: The Xenopus Tgfbi is required for embryogenesis through regulation of canonical Wnt signalling., Dev Biol 2013                              
Most recent:
View All Papers