Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250496

Morpholino Name: tgfbi MO2
Synonyms: Xtgfbi MO2
Target mRNA: tgfbi

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTACTAAGCTCCTCTCACAGCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTGCTGTGAGAGGAGCTTAGTACAG 3' ||||||||||||||||||||||||| 3' GACGACACTCTCCTCGAATCATGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:28829066..28829090 25/25 Antisense target tgfbi.L
chr3S:109309537..109309561 24/25 Antisense off-target LOC108712407 [provisional:tgfbi]
chr1L:183703720..183703744 21/25 Antisense off-target vcan.L
tropicalis 10.0 Chr10:45592505..45592529 21/25 unknown
Publications
First: The Xenopus Tgfbi is required for embryogenesis through regulation of canonical Wnt signalling., Dev Biol 2013                              
Most recent:
View All Papers