Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250522

Morpholino Name: tp53bp1 MO1
Synonyms: 53bp1, TGas057k10, Xt53bp1
Target mRNA: tp53bp1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGATTCTTTGAAGGGTCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 21/24 22/24
genomic

MO
5' GATGGACCCTTCAAAGAATCAGCT 3' |||||||||||||||||||||||| 3' CTACCTGGGAAGTTTCTTAGTCGA 5' 5' GATGGACCCTTCAAGAATTCAGCT 3' |||||||||||||| | |||||| 3' CTACCTGGGAAGTTTCTTAGTCGA 5' 5' GATGGACCCTTCAAGGAATCCGCT 3' |||||||||||||| ||||| ||| 3' CTACCTGGGAAGTTTCTTAGTCGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:46021652..46021675 22/24 Antisense target tp53bp1.S
chr3L:97335852..97335875 21/24 Antisense target tp53bp1.L
chr2L:165026982..165027005 21/24 Sense off-target trpc6.L
chr1L:145094190..145094213 20/24 unknown
chr5L:126147807..126147830 20/24 unknown
chr5L:126394789..126394812 20/24 unknown
tropicalis 10.0 Chr3:107104817..107104840 24/24 Antisense target tp53bp1
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers