Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250587

Morpholino Name: vegt MO3
Synonyms: zVegT MO
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' CATCCGGCAGAGAGTGCATGTTCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25
genomic

MO
5' AGGAACATGCACTCTCTGCCGGGTA 3' |||||||||||||||||||||| | 3' TCCTTGTACGTGAGAGACGGCCTAC 5' 5' AGGAACATGCATTCTCTGCCGGGTA 3' ||||||||||| |||||||||| | 3' TCCTTGTACGTGAGAGACGGCCTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:152591248..152591272 22/25 Antisense target vegt.L
chr1L:116074439..116074463 21/25 Sense off-target sh3gl2.L
tropicalis 10.0 Chr1:152856834..152856858 23/25 Antisense target vegt
Chr1:199583651..199583675 21/25 Sense off-target slc45a2
Chr8:113740480..113740504 21/25 Antisense off-target npas3
Publications
First: Zygotic VegT is required for Xenopus paraxial mesoderm formation and is regulated by Nodal signaling and Eomesodermin., Int J Dev Biol 2010                
Most recent: The Spatiotemporal Control of Zygotic Genome Activation., iScience 2019                            
View All Papers