Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250590

Morpholino Name: vegt MO6
Synonyms: VegTMO
Target mRNA: vegt

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCCCGACAGCAGTTTCTCATTCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' TGCAATGAGAAACTGCTGTCAGGAA 3' || ||||||||||||||||| |||| 3' ACCTTACTCTTTGACGACAGCCCTT 5' 5' TGGAATGAGAAACTGCTGTCGGGAA 3' ||||||||||||||||||||||||| 3' ACCTTACTCTTTGACGACAGCCCTT 5' 5' TGGAATGAGAAACTGCTGTCGGGAA 3' ||||||||||||||||||||||||| 3' ACCTTACTCTTTGACGACAGCCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:126245224..126245248 25/25 Antisense target vegt.S
chr1L:152598797..152598821 25/25 Antisense target vegt.L
chr3L:25022237..25022261 21/25 Antisense off-target LOC108710910
chr9_10L:41262174..41262198 21/25 Sense off-target cox10.L
chr5L:28838374..28838398 22/25 unknown
chr5L:107057469..107057493 21/25 unknown
chr5S:2842311..2842335 21/25 unknown
tropicalis 10.0 Chr1:152863074..152863098 23/25 Antisense target vegt
Chr10:4383089..4383113 21/25 Antisense off-target taf4
Chr5:30906644..30906668 22/25 unknown
Publications
First: Reversal of Xenopus Oct25 function by disruption of the POU domain structure., J Biol Chem 2010  
Most recent:
View All Papers