Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250610

Morpholino Name: wnt2b MO1
Synonyms: Wmo, Xwnt-2b, Wnt-2b morpholino
Target mRNA: wnt2b

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATCCTAGAGGTGGCTGCAATGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATCATCGCAGCCACCTCTAGGATGC 3' ||||| ||||||||||||||||||| 3' TAGTAACGTCGGTGGAGATCCTACG 5' 5' ATCATTGCAGCCACCTCTAGGATGC 3' ||||||||||||||||||||||||| 3' TAGTAACGTCGGTGGAGATCCTACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:77507274..77507298 25/25 Antisense target wnt2b.L
tropicalis 10.0 Chr2:60634665..60634689 24/25 Antisense target wnt2b
Chr1:176714661..176714685 21/25 Antisense off-target cast
Publications
First: Autoregulation of canonical Wnt signaling controls midbrain development., Dev Biol 2004            
Most recent:
View All Papers