Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250631

Morpholino Name: xbp1 MO1
Synonyms: MOxXBP
Target mRNA: xbp1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCCCACGACCACCATGTTGAAGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 22/25
genomic

MO
5' CCTTGGACATGGTGGTCGTGGGAGC 3' |||| ||||||||||||||||||| 3' GGAAGTTGTACCACCAGCACCCTCG 5' 5' CCTTCAACATGGTGGTCGTGGGAGC 3' ||||||||||||||||||||||||| 3' GGAAGTTGTACCACCAGCACCCTCG 5' 5' CCTTGGAAATGGTGGTCGTGGGAGC 3' |||| | ||||||||||||||||| 3' GGAAGTTGTACCACCAGCACCCTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:167311569..167311593 25/25 Antisense target xbp1.L
chr1S:138757003..138757027 22/25 Antisense target xbp1.S
chr1S:172825094..172825118 21/25 unknown
tropicalis 10.0 Chr1:166343708..166343732 23/25 Antisense target xbp1
Chr1:101745319..101745343 23/25 Sense off-target caps
Publications
First: XBP1 forms a regulatory loop with BMP-4 and suppresses mesodermal and neural differentiation in Xenopus embryos., Mech Dev 2006        
Most recent:
View All Papers