Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250632

Morpholino Name: xbp1 MO2
Synonyms: XBP1(C)MO, xbp1 MO
Target mRNA: xbp1

Morpholino Type: uncategorized morpholino
Sequence: 5' GACATCTGGGCCTGCTCCTGCTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TGCAGCAGGAGCAGGCCCAGATGTC 3' ||||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACAG 5' 5' TGCAGCAGGAGCAGGCCCAGATGTC 3' ||||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACAG 5' 5' TGCAGCAGGAGCAGGCCCAGATGTC 3' ||||||||||||||||||||||||| 3' ACGTCGTCCTCGTCCGGGTCTACAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:138765394..138765418 25/25 Antisense target xbp1.S
chr1L:167319406..167319430 25/25 Antisense target xbp1.L
chr2L:86240333..86240357 21/25 Sense off-target LOC108707510 [provisional:csmd2]
chr7L:113590140..113590164 21/25 Sense off-target ppfia3.L
tropicalis 10.0 Chr1:166351551..166351575 25/25 Antisense target xbp1
Chr2:71955007..71955031 21/25 unknown
Publications
First: Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo., Development 2009        
Most recent: IRE1α knockdown rescues tunicamycin-induced developmental defects and apoptosis in Xenopus laevis., J Biomed Res 2014          
View All Papers