Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250633

Morpholino Name: xbp1 MO3
Synonyms: xbp1 ( n ) MO
Target mRNA: xbp1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCCAACAAGAGATCAGACTCAGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 22/25 22/25
genomic

MO
5' TTTACAGTCTGATCTCTTGTTGGGC 3' | |||||||||||||||||||| 3' GAGACTCAGACTAGAGAACAACCCG 5' 5' CTTACAGTCTGATCTCTTGTTGGGC 3' || |||||||||||||||||||| 3' GAGACTCAGACTAGAGAACAACCCG 5' 5' CTTACAGTCTGATCTCTTGTTGGGC 3' || |||||||||||||||||||| 3' GAGACTCAGACTAGAGAACAACCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:167320842..167320866 22/25 Antisense target xbp1.L
chr1S:138766664..138766688 22/25 Antisense target xbp1.S
chr3L:98054916..98054940 21/25 unknown
tropicalis 10.0 Chr1:166353212..166353236 21/25 Antisense target xbp1
Publications
First: Coordinated activation of the secretory pathway during notochord formation in the Xenopus embryo., Development 2009        
Most recent:
View All Papers