Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250635

Morpholino Name: xiap MO1
Synonyms: XIAP MO#2
Target mRNA: xiap

Morpholino Type: uncategorized morpholino
Sequence: 5' GGAACCACAACCTTCCTACCGGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' CTTCCGGTAGGAAGGTTGTGGTTCC 3' |||||||||||||||||||||| 3' CTCGGCCATCCTTCCAACACCAAGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:26874763..26874787 22/25 Antisense target xiap.L
Publications
First: XIAP monoubiquitylates Groucho/TLE to promote canonical Wnt signaling., Mol Cell 2012    
Most recent:
View All Papers