Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250643

Morpholino Name: ywhab MO1
Synonyms: 14-3-3beta, TTpA010k20, Xt14-3-3beta
Target mRNA: ywhab

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTACCAGTTCGCTCTTGTCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CATGGACAAGAGCGAACTGGTACAG 3' ||||||||||||||||||||||||| 3' GTACCTGTTCTCGCTTGACCATGTC 5' 5' CATGGACAAGAGTGAACTGGTACAG 3' |||||||||||| |||||||||||| 3' GTACCTGTTCTCGCTTGACCATGTC 5' 5' CATGGACAAGAGTGAACTGGTACAG 3' |||||||||||| |||||||||||| 3' GTACCTGTTCTCGCTTGACCATGTC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:3724459..3724483 24/25 Antisense target ywhab.L
chr9_10S:3409734..3409758 24/25 Antisense target ywhab.S
tropicalis 10.0 Chr10:12519438..12519462 25/25 Antisense target ywhab
Chr6:145717867..145717891 21/25 Sense off-target Xetrov107045555m.g
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers