Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250644

Morpholino Name: ywhab MO2
Synonyms: 14-3-3beta, TTpA010k20, Xt14-3-3beta.2
Target mRNA: ywhab

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTCAAAAATCCGCGACCTGCCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TTGGCAGGTCGCGGATTTTTGAGGT 3' ||||||||||||||||||||||| | 3' AACCGTCCAGCGCCTAAAAACTCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr10:12513021..12513045 24/25 Antisense target ywhab
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers