Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250646

Morpholino Name: ywhae MO1
Synonyms: 14-3-3epsilon, TTpA018g17, Xt14-3-3epsilon
Target mRNA: ywhae

Morpholino Type: uncategorized morpholino
Sequence: 5' ACACTAGATCCTCTCGCTCTTCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGGAAGAGCGAGAGGATCTAGTGT 3' ||||||||||||||||||||||||| 3' TACCTTCTCGCTCTCCTAGATCACA 5' 5' ATGGAAGAGCGAGAGGATCTAGTGT 3' ||||||||||||||||||||||||| 3' TACCTTCTCGCTCTCCTAGATCACA 5' 5' ATGGAAGAGCGAGAGGATCTAGTGT 3' ||||||||||||||||||||||||| 3' TACCTTCTCGCTCTCCTAGATCACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:45273104..45273128 25/25 Antisense target ywhae.L
chr2S:34332045..34332069 25/25 Antisense target ywhae.S
chr3S:20385744..20385768 21/25 unknown
tropicalis 10.0 Chr2:46069710..46069734 25/25 Antisense target ywhae
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers