Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250652

Morpholino Name: ywhah MO2
Synonyms: 14-3-3eta, TGas138o08, Xt14-3-3eta.2
Target mRNA: ywhah

Morpholino Type: uncategorized morpholino
Sequence: 5' AGACGCCGGTCTGTGCTGTGGATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 21/24
genomic

MO
5' GATCCACAGCACAGACCGGCGTCT 3' |||||||||||||||||||||||| 3' CTAGGTGTCGTGTCTGGCCGCAGA 5' 5' GTACCAGAGCACAGACCGGCGTCT 3' | ||| ||||||||||||||||| 3' CTAGGTGTCGTGTCTGGCCGCAGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:151944017..151944040 21/24 Antisense target ywhah.L
tropicalis 10.0 Chr1:152234383..152234406 24/24 Antisense target ywhah
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers